Transcript: Human XM_011529725.2

PREDICTED: Homo sapiens trafficking protein particle complex 10 (TRAPPC10), transcript variant X16, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRAPPC10 (7109)
Length:
3404
CDS:
163..3276

Additional Resources:

NCBI RefSeq record:
XM_011529725.2
NBCI Gene record:
TRAPPC10 (7109)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529725.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060046 GCTGTGATACCGAAGTGTATA pLKO.1 443 CDS 100% 13.200 18.480 N TRAPPC10 n/a
2 TRCN0000060044 CCGAACCTCTATTGTGGACAA pLKO.1 588 CDS 100% 4.050 5.670 N TRAPPC10 n/a
3 TRCN0000060045 GCTCCGAAGATGATTCACCTA pLKO.1 325 CDS 100% 2.640 2.112 N TRAPPC10 n/a
4 TRCN0000060047 CCTGTGCTGGAGATCAGAATT pLKO.1 227 CDS 100% 0.000 0.000 N TRAPPC10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529725.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11193 pDONR223 100% 26.1% 25.3% None (many diffs) n/a
2 ccsbBroad304_11193 pLX_304 0% 26.1% 25.3% V5 (many diffs) n/a
3 TRCN0000472419 ATCTTAGACCGACATAGCGTTTGA pLX_317 47.2% 26.1% 25.3% V5 (many diffs) n/a
Download CSV