Transcript: Human XM_011529755.2

PREDICTED: Homo sapiens chromatin assembly factor 1 subunit B (CHAF1B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHAF1B (8208)
Length:
2218
CDS:
639..1757

Additional Resources:

NCBI RefSeq record:
XM_011529755.2
NBCI Gene record:
CHAF1B (8208)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529755.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074280 GCAAGAAGCTACCGGATGTTT pLKO.1 741 CDS 100% 5.625 7.875 N CHAF1B n/a
2 TRCN0000074279 CGTCATACCAAAGCCGTCAAT pLKO.1 364 5UTR 100% 4.950 6.930 N CHAF1B n/a
3 TRCN0000074282 GCGAGTATACAGTATACAGAA pLKO.1 662 CDS 100% 4.950 3.960 N CHAF1B n/a
4 TRCN0000074281 CATCCTATTGTGGAAGGTGAA pLKO.1 441 5UTR 100% 4.050 2.835 N CHAF1B n/a
5 TRCN0000074278 GCTGTTGTATTCAGTATCCAT pLKO.1 1924 3UTR 100% 3.000 2.100 N CHAF1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529755.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01870 pDONR223 100% 66.5% 65.7% None 0_1ins464;15_16ins97 n/a
2 ccsbBroad304_01870 pLX_304 0% 66.5% 65.7% V5 0_1ins464;15_16ins97 n/a
3 TRCN0000470290 GCCAATCTAAGGCACACCCGCACG pLX_317 27.2% 66.5% 65.7% V5 0_1ins464;15_16ins97 n/a
Download CSV