Transcript: Human XM_011529914.2

PREDICTED: Homo sapiens HORMA domain containing 2 (HORMAD2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HORMAD2 (150280)
Length:
1477
CDS:
461..1462

Additional Resources:

NCBI RefSeq record:
XM_011529914.2
NBCI Gene record:
HORMAD2 (150280)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529914.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000443169 GTCCCGGGTCACTGCATATTA pLKO_005 690 CDS 100% 15.000 21.000 N HORMAD2 n/a
2 TRCN0000127782 GCAGCAGTACAAGCTTTGAAA pLKO.1 876 CDS 100% 5.625 3.938 N HORMAD2 n/a
3 TRCN0000127569 CAGTGTTCTACTGATCCGTAA pLKO.1 928 CDS 100% 4.050 2.835 N HORMAD2 n/a
4 TRCN0000127821 GAACAATCTGTTTCGGGAGAA pLKO.1 1195 CDS 100% 4.050 2.835 N HORMAD2 n/a
5 TRCN0000128886 GAAGAAGAATGCAATGACCAT pLKO.1 1259 CDS 100% 2.640 1.848 N HORMAD2 n/a
6 TRCN0000127726 GTTTGACAAGGAGCCTATCAA pLKO.1 1090 CDS 100% 5.625 3.375 N HORMAD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529914.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05038 pDONR223 100% 87.7% 83.7% None (many diffs) n/a
2 ccsbBroad304_05038 pLX_304 0% 87.7% 83.7% V5 (many diffs) n/a
3 TRCN0000467171 AATTCCAATACGTCGGGCCACCTA pLX_317 38% 87.7% 83.7% V5 (many diffs) n/a
Download CSV