Construct: ORF TRCN0000467171
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009480.1_s317c1
- Derived from:
- ccsbBroadEn_05038
- DNA Barcode:
- AATTCCAATACGTCGGGCCACCTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HORMAD2 (150280)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467171
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 150280 | HORMAD2 | HORMA domain containing 2 | NM_001329457.2 | 100% | 100% | |
| 2 | human | 150280 | HORMAD2 | HORMA domain containing 2 | NM_152510.4 | 100% | 100% | |
| 3 | human | 150280 | HORMAD2 | HORMA domain containing 2 | XM_011529917.3 | 100% | 100% | |
| 4 | human | 150280 | HORMAD2 | HORMA domain containing 2 | XM_011529918.1 | 89.6% | 88.9% | (many diffs) |
| 5 | human | 150280 | HORMAD2 | HORMA domain containing 2 | XM_011529914.2 | 87.7% | 83.7% | (many diffs) |
| 6 | human | 150280 | HORMAD2 | HORMA domain containing 2 | XM_017028621.1 | 87.7% | 83.7% | (many diffs) |
| 7 | human | 150280 | HORMAD2 | HORMA domain containing 2 | XM_017028622.1 | 87.7% | 83.7% | (many diffs) |
| 8 | human | 150280 | HORMAD2 | HORMA domain containing 2 | NM_001329458.2 | 71.3% | 67.9% | 0_1ins227;30_31ins37 |
| 9 | human | 150280 | HORMAD2 | HORMA domain containing 2 | XM_017028624.1 | 61.6% | 54.3% | (many diffs) |
| 10 | human | 150280 | HORMAD2 | HORMA domain containing 2 | XM_017028625.1 | 56.8% | 50.4% | (many diffs) |
| 11 | human | 150280 | HORMAD2 | HORMA domain containing 2 | XM_017028626.1 | 47.9% | 42.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 987
- ORF length:
- 921
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cactgctcag ctttctcact gcatcacaat acacaaggct tctaaggaaa 121 cagttttccc atcccaaatc actaatgagc atgagtcatt gaaaatggtg aagaaacttt 181 ttgctacttc catctcatgt ataacatacc taaggggcct gtttccagag agctcttatg 241 gagaacgcca tttggatgac ctcagtttaa aaatcctccg agaagataaa aaatgtcccg 301 ggtcactgca tattatcaga tggattcaag gttgttttga tgctttggaa aagagatacc 361 tacgtatggc agtactgaca ctttacacag atcccatggg atctgagaag gtgactgaga 421 tgtaccagtt caaattcaaa tacacgaaag aaggagccac tatggatttt gacagtcata 481 gcagcagtac aagctttgaa agtggaacaa acaatgaaga tattaagaaa gccagtgttc 541 tactgatccg taaattgtat atactgatgc aggaccttga gccacttcct aataatgttg 601 tacttactat gaaactccac tactataatg cagtgacccC ACATGATTAC CAACCCCTCG 661 GTTTTAAAGA AGGGGTAAAT TCACACTTCC TGCTGTTTGA CAAGGAGCCT ATCAACGTGC 721 AAGTGGGATT TGTCTCCACT GGCTTTCATA GCATGAAAGT AAAAGTCATG ACAGAGGCTA 781 CAAAAGTGAT TGATTTGGAG AACAATCTGT TTCGGGAGAA CAGCACTACT GAGATCGCCC 841 ATCAGGGTCT AGACTGTGAT GAGGAAGAAG AATGCAATGA CCATATTCAA AGAATGAATT 901 TTGTGTGCAG TCAGCAAAGT TCTGAGTGCT CCAGGAAGAA GAGGAAGGTC AGTGAACCAG 961 TGAAGGTCTT CATCCCTAAC AGAAAATGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 1021 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1081 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAAATTCCAA 1141 TACGTCGGGC CACCTAACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1201 aagatt