Transcript: Human XM_011529952.2

PREDICTED: Homo sapiens meiotic double-stranded break formation protein 1 (MEI1), transcript variant X27, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MEI1 (150365)
Length:
3528
CDS:
567..3350

Additional Resources:

NCBI RefSeq record:
XM_011529952.2
NBCI Gene record:
MEI1 (150365)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529952.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246331 CAGACCTGCAGCTAGTCTATA pLKO_005 1789 CDS 100% 13.200 18.480 N MEI1 n/a
2 TRCN0000257508 TATCCAAGTGGGCGGTCTTAT pLKO_005 2105 CDS 100% 13.200 18.480 N MEI1 n/a
3 TRCN0000257501 CAGCTCACAAGGTACTGATTA pLKO_005 2053 CDS 100% 13.200 10.560 N MEI1 n/a
4 TRCN0000246332 CAGCACTCTGGAGGGATTTAG pLKO_005 986 CDS 100% 13.200 9.240 N MEI1 n/a
5 TRCN0000257522 TCCAATTTCCTCTACTATATG pLKO_005 1359 CDS 100% 13.200 9.240 N MEI1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529952.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13263 pDONR223 100% 25.6% 25.6% None 1_1890del;1999_2043del;2493_2624del n/a
2 ccsbBroad304_13263 pLX_304 0% 25.6% 25.6% V5 1_1890del;1999_2043del;2493_2624del n/a
3 TRCN0000465600 GACCTATTTATTGCTCGGAAATTT pLX_317 34% 25.6% 25.6% V5 1_1890del;1999_2043del;2493_2624del n/a
Download CSV