Construct: ORF TRCN0000465600
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000050.1_s317c1
- Derived from:
- ccsbBroadEn_13263
- DNA Barcode:
- GACCTATTTATTGCTCGGAAATTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MEI1 (150365)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465600
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 150365 | MEI1 | meiotic double-stranded bre... | XM_011529954.2 | 28.6% | 28.6% | 1_1599del;1708_1752del;2202_2333del |
| 2 | human | 150365 | MEI1 | meiotic double-stranded bre... | XM_011529952.2 | 25.6% | 25.6% | 1_1890del;1999_2043del;2493_2624del |
| 3 | human | 150365 | MEI1 | meiotic double-stranded bre... | XM_011529949.2 | 23% | 23% | 1_2202del;2311_2355del;2805_2936del |
| 4 | human | 150365 | MEI1 | meiotic double-stranded bre... | XM_011529948.3 | 21.9% | 21.9% | 1_2367del;2476_2520del;2970_3101del |
| 5 | human | 150365 | MEI1 | meiotic double-stranded bre... | XM_011529947.2 | 21.3% | 21.3% | 1_2454del;2563_2607del;3057_3188del |
| 6 | human | 150365 | MEI1 | meiotic double-stranded bre... | XM_011529946.2 | 20.7% | 20.7% | 1_2544del;2653_2697del;3147_3278del |
| 7 | human | 150365 | MEI1 | meiotic double-stranded bre... | XM_011529943.2 | 19.8% | 19.8% | 1_2700del;2809_2853del;3303_3434del |
| 8 | human | 150365 | MEI1 | meiotic double-stranded bre... | XM_011529942.3 | 19.4% | 19.4% | 1_2784del;2893_2937del;3387_3518del |
| 9 | human | 150365 | MEI1 | meiotic double-stranded bre... | XM_011529941.2 | 19.3% | 19.3% | 1_2976del |
| 10 | human | 150365 | MEI1 | meiotic double-stranded bre... | XM_011529940.2 | 19.2% | 19.2% | 1_2871del;3429_3560del |
| 11 | human | 150365 | MEI1 | meiotic double-stranded bre... | XM_011529939.2 | 19.1% | 19.1% | 1_2976del;3085_3129del |
| 12 | human | 150365 | MEI1 | meiotic double-stranded bre... | XM_011529938.2 | 19% | 19% | 1_2859del;2968_3012del;3462_3593del |
| 13 | human | 150365 | MEI1 | meiotic double-stranded bre... | XM_011529937.2 | 18.9% | 18.9% | 1_2871del;2980_3024del;3474_3605del |
| 14 | human | 150365 | MEI1 | meiotic double-stranded bre... | NM_152513.4 | 18.6% | 18.6% | 1_2976del;3534_3665del |
| 15 | human | 150365 | MEI1 | meiotic double-stranded bre... | XM_011529935.2 | 18.6% | 18.6% | 1_2940del;3049_3093del;3543_3674del |
| 16 | human | 150365 | MEI1 | meiotic double-stranded bre... | XM_011529945.3 | 18.4% | 18.4% | 1_2976del;3085_3129del;3579_3710del |
| 17 | human | 150365 | MEI1 | meiotic double-stranded bre... | XR_937822.3 | 17.6% | 1_3024del;3582_3713del;3871_4035del | |
| 18 | human | 150365 | MEI1 | meiotic double-stranded bre... | XM_017028633.2 | 17.1% | 17.1% | 1_2976del;3167_3168ins60;3474_3605del |
| 19 | human | 150365 | MEI1 | meiotic double-stranded bre... | XM_011529936.2 | 16.9% | 16.9% | (many diffs) |
| 20 | human | 150365 | MEI1 | meiotic double-stranded bre... | XR_937817.2 | 13.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 780
- ORF length:
- 714
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct ggccctcacc ttggcaaagg cagattctcc caggactgca ctcctctgct 121 ctgcctggct gctcactgcc tccttctctg cccagcagca caagggcagt ttgcaggttc 181 accagacact ctctgtggaa atggaccaag tattgaaggc tctcagcttt ccaaagaaaa 241 aggctgcact actctcagct gccatcttat gcttcctgcg gacagccctg cgacaaagct 301 tttcctctgc cctggtagcc ctggtgccct caggggccca gccactgcca gccaccaagg 361 acactgtcct agctccactg cgaatgtcgc aagtccggtc cctggtcatt gggctgcaga 421 acctcctggt gcagaaggac cctctattgt cccaggcctg tgttggctgc ctggaggcct 481 tgcttgacta cctggatgcc cggagcccag acattgctct ccacgtggcc tcccagcctt 541 GGAATCGGTT TTTGCTGTTT ACCCTCTTGG ATGCTGGAGA GAATTCCTTC CTCAGACCTG 601 AGATTTTGAG GCTCATGACC CTGCTCCAGA GCATGGGACA CCTGGCTGAC CACAGCATGG 661 CCCAGACCCT GCAGGCCTCC TTGGAGGGCC TTCCCCCTAG CACCTCCTCA GGCCAGCCAC 721 CCCTGCAGGA CATGCTCTGC CTGGGAGGGG TGGCTGTATC CCTGTCCCAC ATCAGAAACT 781 GCCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 841 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 901 TTTATATATC TTGTGGAAAG GACGAGACCT ATTTATTGCT CGGAAATTTA CGCGTTAAGT 961 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt