Transcript: Human XM_011530040.2

PREDICTED: Homo sapiens RASD family member 2 (RASD2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RASD2 (23551)
Length:
3808
CDS:
1037..1837

Additional Resources:

NCBI RefSeq record:
XM_011530040.2
NBCI Gene record:
RASD2 (23551)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530040.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047916 CTTCCACCGTAAGGTATACAA pLKO.1 1198 CDS 100% 5.625 7.875 N RASD2 n/a
2 TRCN0000047917 CGACGAGAACTGCGCCTACTT pLKO.1 1522 CDS 100% 1.650 2.310 N RASD2 n/a
3 TRCN0000047915 CCTGGATAACCGGGAGTCCTT pLKO.1 1333 CDS 100% 0.880 1.232 N RASD2 n/a
4 TRCN0000419870 GTGAGGATTGCTGCGTCATAT pLKO_005 2154 3UTR 100% 13.200 9.240 N RASD2 n/a
5 TRCN0000425875 ACACCAACGTGGACGAGATGT pLKO_005 1563 CDS 100% 4.950 3.465 N RASD2 n/a
6 TRCN0000047913 CGTCAACAGTGACCTCAAGTA pLKO.1 1753 CDS 100% 4.950 3.465 N RASD2 n/a
7 TRCN0000047914 CCTCAAGTACATCAAGGCCAA pLKO.1 1765 CDS 100% 2.160 1.296 N RASD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530040.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02793 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02793 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480383 TCCCTTTGCTATTTGATTCGGGCT pLX_317 54% 100% 100% V5 n/a
Download CSV