Transcript: Human XM_011530113.1

PREDICTED: Homo sapiens transmembrane protein 184B (TMEM184B), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM184B (25829)
Length:
3626
CDS:
189..1448

Additional Resources:

NCBI RefSeq record:
XM_011530113.1
NBCI Gene record:
TMEM184B (25829)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530113.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150782 GAAAGACTTATTCCATCGGAT pLKO.1 673 CDS 100% 2.640 3.696 N TMEM184B n/a
2 TRCN0000156742 GTTCTTCATGGTCAAGTCCGT pLKO.1 932 CDS 100% 0.660 0.924 N TMEM184B n/a
3 TRCN0000421087 ATGGGCCTTCAGGAATATTTA pLKO_005 1626 3UTR 100% 15.000 10.500 N TMEM184B n/a
4 TRCN0000438414 GACACTGGGAGCAAGGCTTAT pLKO_005 1685 3UTR 100% 10.800 7.560 N TMEM184B n/a
5 TRCN0000158117 CATGTCGGAGATCAGAGGAAA pLKO.1 608 CDS 100% 4.950 3.465 N TMEM184B n/a
6 TRCN0000153494 CGTGACCATCATCTACAACAT pLKO.1 827 CDS 100% 4.950 3.465 N TMEM184B n/a
7 TRCN0000157884 CAACGACCAGTACTACGTGTA pLKO.1 497 CDS 100% 4.050 2.835 N TMEM184B n/a
8 TRCN0000157290 CCATCGGATTTCTGAGGTTCT pLKO.1 685 CDS 100% 4.050 2.835 N TMEM184B n/a
9 TRCN0000153824 CCTCAAGTTCTTCATGGTCAA pLKO.1 926 CDS 100% 4.050 2.835 N TMEM184B n/a
10 TRCN0000154251 CATCTTTCTTTCCTTCTGGCA pLKO.1 953 CDS 100% 0.660 0.396 N TMEM184B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530113.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02867 pDONR223 100% 97.1% 97.1% None 981_1016del n/a
2 ccsbBroad304_02867 pLX_304 0% 97.1% 97.1% V5 981_1016del n/a
3 TRCN0000473765 TGCTATGCCCGCCGTCACCCCTTT pLX_317 33.1% 97.1% 97.1% V5 981_1016del n/a
Download CSV