Transcript: Human XM_011530727.2

PREDICTED: Homo sapiens protein phosphatase 6 regulatory subunit 2 (PPP6R2), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPP6R2 (9701)
Length:
3732
CDS:
1..2889

Additional Resources:

NCBI RefSeq record:
XM_011530727.2
NBCI Gene record:
PPP6R2 (9701)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530727.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143209 GAACTATGCATAGCCGCTATT pLKO.1 1243 CDS 100% 10.800 15.120 N PPP6R2 n/a
2 TRCN0000139866 GACCAGGACGACAACATCAAT pLKO.1 1750 CDS 100% 5.625 7.875 N PPP6R2 n/a
3 TRCN0000144656 GCTGGACTTGTTCTTTAAGTA pLKO.1 1191 CDS 100% 5.625 7.875 N PPP6R2 n/a
4 TRCN0000121575 CGCTTCAAATATCCAAACACA pLKO.1 286 CDS 100% 3.000 4.200 N PPP6R2 n/a
5 TRCN0000139734 CTGTACGACTTCTTGGACCAT pLKO.1 382 CDS 100% 2.640 3.696 N PPP6R2 n/a
6 TRCN0000139709 GTGTTACTCACCTTGCTGGAA pLKO.1 880 CDS 100% 2.640 3.696 N PPP6R2 n/a
7 TRCN0000145433 GATGAAGATAGGCAGTCAAAT pLKO.1 676 CDS 100% 13.200 9.240 N PPP6R2 n/a
8 TRCN0000145052 CAGGAGTTAATGGATGAAGAT pLKO.1 139 CDS 100% 4.950 3.465 N PPP6R2 n/a
9 TRCN0000139026 CAAGTTCATCAGCCTGGTGTT pLKO.1 507 CDS 100% 4.050 2.835 N PPP6R2 n/a
10 TRCN0000122130 GCTGAATGAAGAGAAGGTCAT pLKO.1 621 CDS 100% 4.050 2.835 N PPP6R2 n/a
11 TRCN0000139407 GCAAGACCATTGGCAATCTCA pLKO.1 440 CDS 100% 3.000 2.100 N PPP6R2 n/a
12 TRCN0000140903 CCAAGAAGAAAGCGATCCTGA pLKO.1 1037 CDS 100% 2.640 1.848 N PPP6R2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530727.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07471 pDONR223 100% 96.8% 96.7% None (many diffs) n/a
2 ccsbBroad304_07471 pLX_304 0% 96.8% 96.7% V5 (many diffs) n/a
Download CSV