Transcript: Human XM_011530867.3

PREDICTED: Homo sapiens uracil phosphoribosyltransferase homolog (UPRT), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UPRT (139596)
Length:
1972
CDS:
170..685

Additional Resources:

NCBI RefSeq record:
XM_011530867.3
NBCI Gene record:
UPRT (139596)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530867.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421399 TGCCTATGAATGATCAGATAC pLKO_005 507 CDS 100% 10.800 7.560 N UPRT n/a
2 TRCN0000155595 CCTGTCACAACCAGCAAGTAA pLKO.1 204 CDS 100% 5.625 3.938 N UPRT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530867.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09583 pDONR223 100% 53.4% 47.8% None (many diffs) n/a
2 ccsbBroad304_09583 pLX_304 0% 53.4% 47.8% V5 (many diffs) n/a
3 TRCN0000465960 GTAATTTTCATGTTATTGAATACA pLX_317 33.3% 53.4% 47.8% V5 (many diffs) n/a
Download CSV