Transcript: Human XM_011531182.3

PREDICTED: Homo sapiens trimethyllysine hydroxylase, epsilon (TMLHE), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMLHE (55217)
Length:
2725
CDS:
193..1305

Additional Resources:

NCBI RefSeq record:
XM_011531182.3
NBCI Gene record:
TMLHE (55217)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531182.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064804 GCACACTGACACTACCTATTT pLKO.1 762 CDS 100% 13.200 18.480 N TMLHE n/a
2 TRCN0000064806 CCAAAGACCATTCGTCTGGAT pLKO.1 355 CDS 100% 2.640 3.696 N TMLHE n/a
3 TRCN0000064807 CGCTTTGATTACGTCTGGCTT pLKO.1 247 CDS 100% 2.640 3.696 N TMLHE n/a
4 TRCN0000064805 CCGGACTCTAACGATAGAGTT pLKO.1 1107 CDS 100% 0.495 0.693 N TMLHE n/a
5 TRCN0000064803 CCTCAGTAAAGTGCCATTGAA pLKO.1 912 CDS 100% 5.625 3.938 N TMLHE n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531182.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03551 pDONR223 100% 71.2% 64.6% None (many diffs) n/a
2 ccsbBroad304_03551 pLX_304 0% 71.2% 64.6% V5 (many diffs) n/a
3 TRCN0000469125 GCATAAAGATCGCATCCGCGAGCT pLX_317 33.6% 71.2% 64.6% V5 (many diffs) n/a
Download CSV