Transcript: Human XM_011531202.2

PREDICTED: Homo sapiens CD99 molecule like 2 (CD99L2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CD99L2 (83692)
Length:
623
CDS:
130..567

Additional Resources:

NCBI RefSeq record:
XM_011531202.2
NBCI Gene record:
CD99L2 (83692)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531202.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149059 GCAGTGAAAGAAACTTCCTCA pLKO.1 232 CDS 100% 2.640 1.848 N CD99L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531202.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14297 pDONR223 100% 99.7% 99.3% None 422T>G n/a
2 ccsbBroad304_14297 pLX_304 0% 99.7% 99.3% V5 422T>G n/a
3 TRCN0000466178 TACAGGTATGTTATAAATGTCCAC pLX_317 77.3% 99.7% 99.3% V5 422T>G n/a
Download CSV