Transcript: Human XM_011531833.1

PREDICTED: Homo sapiens prostate androgen-regulated mucin-like protein 1 (PARM1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PARM1 (25849)
Length:
5116
CDS:
213..1250

Additional Resources:

NCBI RefSeq record:
XM_011531833.1
NBCI Gene record:
PARM1 (25849)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531833.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166726 CTTCTGGGTTCTCGTCAACAA pLKO.1 634 CDS 100% 4.950 6.930 N PARM1 n/a
2 TRCN0000166154 CATCACCCTCATCCCTATCAA pLKO.1 784 CDS 100% 5.625 4.500 N PARM1 n/a
3 TRCN0000165722 CCTCCGTTACTACCAACCATA pLKO.1 829 CDS 100% 4.950 3.465 N PARM1 n/a
4 TRCN0000160843 GATGTGTGAGCTCATAGACAT pLKO.1 1004 CDS 100% 4.950 3.465 N PARM1 n/a
5 TRCN0000166727 CAACTGTGTCAGGCAAAGTGA pLKO.1 985 CDS 100% 3.000 2.100 N PARM1 n/a
6 TRCN0000158559 CTAAGAACATTTCCATAGAGT pLKO.1 550 CDS 100% 3.000 2.100 N PARM1 n/a
7 TRCN0000164989 GTCAGGCAAAGTGATGTGTGA pLKO.1 992 CDS 100% 2.640 1.848 N PARM1 n/a
8 TRCN0000162383 CAAACATTGTACCACCGACTA pLKO.1 415 CDS 100% 4.050 2.835 N PARM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531833.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07952 pDONR223 100% 89.6% 89.5% None 39T>C;43_147del;472G>A n/a
2 ccsbBroad304_07952 pLX_304 0% 89.6% 89.5% V5 39T>C;43_147del;472G>A n/a
3 TRCN0000467462 TTGTGAGCGCACTTAAGCTAAGCC pLX_317 45% 89.6% 89.5% V5 39T>C;43_147del;472G>A n/a
Download CSV