Transcript: Human XM_011531919.2

PREDICTED: Homo sapiens tripartite motif family like 1 (TRIML1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRIML1 (339976)
Length:
1960
CDS:
474..1589

Additional Resources:

NCBI RefSeq record:
XM_011531919.2
NBCI Gene record:
TRIML1 (339976)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531919.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430971 GTTCTCACTAATAGGTTTAAA pLKO_005 1307 CDS 100% 15.000 21.000 N TRIML1 n/a
2 TRCN0000424689 TCAAAGCTCGGCTTTCGAATC pLKO_005 890 CDS 100% 6.000 8.400 N TRIML1 n/a
3 TRCN0000221023 GAGGAACATAACACACCTTTA pLKO.1 315 5UTR 100% 10.800 8.640 N TRIML1 n/a
4 TRCN0000444246 GGAAGCTCAGGCTGTACTAAC pLKO_005 635 CDS 100% 10.800 8.640 N TRIML1 n/a
5 TRCN0000424326 ACAGGTTGTTGTGTCAGAATA pLKO_005 707 CDS 100% 13.200 9.240 N TRIML1 n/a
6 TRCN0000221019 GCCAGGAAGAAACAAAGACTT pLKO.1 682 CDS 100% 4.950 3.465 N TRIML1 n/a
7 TRCN0000221022 TGGACTATGAATCTGGACATA pLKO.1 1414 CDS 100% 4.950 3.465 N TRIML1 n/a
8 TRCN0000221020 CCCAGCAAATCAGAAGCCTAA pLKO.1 838 CDS 100% 4.050 2.835 N TRIML1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531919.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14477 pDONR223 100% 51.6% 51.4% None 1_537del;549G>T n/a
2 ccsbBroad304_14477 pLX_304 0% 51.6% 51.4% V5 1_537del;549G>T n/a
3 TRCN0000474537 ATCTGAGTAAAGTTAGCATTATTG pLX_317 97.8% 51.6% 51.4% V5 1_537del;549G>T n/a
Download CSV