Transcript: Human XM_011531927.2

PREDICTED: Homo sapiens inhibitor of growth family member 2 (ING2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ING2 (3622)
Length:
985
CDS:
157..834

Additional Resources:

NCBI RefSeq record:
XM_011531927.2
NBCI Gene record:
ING2 (3622)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531927.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358803 ATAGAAGATCGAGGTAGTAAA pLKO_005 818 CDS 100% 13.200 18.480 N ING2 n/a
2 TRCN0000019214 CCAGTGAAAGCCGTGATTTAT pLKO.1 461 CDS 100% 15.000 12.000 N ING2 n/a
3 TRCN0000019216 CCTGTTGAGTTTGCAATAGAT pLKO.1 595 CDS 100% 5.625 4.500 N ING2 n/a
4 TRCN0000019215 CGGGCAAGACAAATGGAGTTA pLKO.1 331 CDS 100% 4.950 3.960 N ING2 n/a
5 TRCN0000358804 TTCTCCAGAGAGCACTAATTA pLKO_005 245 CDS 100% 15.000 10.500 N ING2 n/a
6 TRCN0000358805 GACCAGTGAAAGCCGTGATTT pLKO_005 459 CDS 100% 13.200 9.240 N ING2 n/a
7 TRCN0000019218 CATGTGTTTCACTTACCTATA pLKO.1 713 CDS 100% 10.800 7.560 N ING2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531927.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06453 pDONR223 100% 80% 79.6% None 0_1ins166;3G>C;6delT n/a
2 ccsbBroad304_06453 pLX_304 0% 80% 79.6% V5 0_1ins166;3G>C;6delT n/a
Download CSV