Transcript: Human XM_011532162.2

PREDICTED: Homo sapiens methyltransferase like 14 (METTL14), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
METTL14 (57721)
Length:
2518
CDS:
161..1036

Additional Resources:

NCBI RefSeq record:
XM_011532162.2
NBCI Gene record:
METTL14 (57721)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532162.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015935 GCCGTGTTAAATAGCAAAGAT pLKO.1 257 CDS 100% 5.625 7.875 N METTL14 n/a
2 TRCN0000015933 CCATGTACTTACAAGCCGATA pLKO.1 660 CDS 100% 4.050 5.670 N METTL14 n/a
3 TRCN0000424895 AGGATGAGTTAATAGCTAAAT pLKO_005 627 CDS 100% 13.200 9.240 N METTL14 n/a
4 TRCN0000015936 GCCGTGGACGAGAAAGAAATA pLKO.1 1270 3UTR 100% 13.200 9.240 N METTL14 n/a
5 TRCN0000015934 GCTTACAAATAGCAACTACAA pLKO.1 1088 3UTR 100% 4.950 3.465 N METTL14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532162.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03848 pDONR223 100% 58% 57.6% None 738_787del;873_874ins545 n/a
2 ccsbBroad304_03848 pLX_304 0% 58% 57.6% V5 738_787del;873_874ins545 n/a
3 TRCN0000468454 CATGACGGTATTAGCTCCCTGCCC pLX_317 34% 58% 57.6% V5 738_787del;873_874ins545 n/a
Download CSV