Transcript: Human XM_011532211.1

PREDICTED: Homo sapiens betacellulin (BTC), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BTC (685)
Length:
1521
CDS:
343..879

Additional Resources:

NCBI RefSeq record:
XM_011532211.1
NBCI Gene record:
BTC (685)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532211.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117973 CCTCTTCGGAAACGTCGTAAA pLKO.1 772 CDS 100% 10.800 15.120 N BTC n/a
2 TRCN0000117976 GCCCTGGGTCTAGTGATCCTT pLKO.1 400 CDS 100% 1.000 0.800 N BTC n/a
3 TRCN0000371376 CTCCTATCAATGAAGATATTG pLKO_005 839 CDS 100% 13.200 9.240 N BTC n/a
4 TRCN0000371434 GCTACCACCACACAATCAAAG pLKO_005 505 CDS 100% 10.800 7.560 N BTC n/a
5 TRCN0000117974 CCACCAGAAGTCCTGAAACTA pLKO.1 446 CDS 100% 5.625 3.938 N BTC n/a
6 TRCN0000117975 GCAATACAAGCATTACTGCAT pLKO.1 555 CDS 100% 2.640 1.848 N BTC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532211.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05906 pDONR223 100% 99.8% 99.4% None 370T>A n/a
2 ccsbBroad304_05906 pLX_304 0% 99.8% 99.4% V5 370T>A n/a
3 TRCN0000467801 ACTTGGTTAAGTTCGTTCAGCCCG pLX_317 71.8% 99.8% 99.4% V5 370T>A n/a
Download CSV