Transcript: Human XM_011532216.2

PREDICTED: Homo sapiens toll like receptor 2 (TLR2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TLR2 (7097)
Length:
7864
CDS:
129..2483

Additional Resources:

NCBI RefSeq record:
XM_011532216.2
NBCI Gene record:
TLR2 (7097)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532216.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358740 TACGTGGATGTACCGTCATTT pLKO_005 2574 3UTR 100% 13.200 18.480 N TLR2 n/a
2 TRCN0000057018 GCACACGAATACACAGTGTAA pLKO.1 1462 CDS 100% 4.950 6.930 N TLR2 n/a
3 TRCN0000057022 CCCATGTTACTAGTATTGAAA pLKO.1 1623 CDS 100% 0.000 0.000 N TLR2 n/a
4 TRCN0000358744 TTTGATGACTGTACCCTTAAT pLKO_005 978 CDS 100% 13.200 9.240 N TLR2 n/a
5 TRCN0000358742 ACTTATCCAGCACACGAATAC pLKO_005 1453 CDS 100% 10.800 7.560 N TLR2 n/a
6 TRCN0000057021 GCATCTGATAATGACAGAGTT pLKO.1 1017 CDS 100% 4.950 3.465 N TLR2 n/a
7 TRCN0000057019 GCGGAAGATAATGAACACCAA pLKO.1 2384 CDS 100% 2.640 1.848 N TLR2 n/a
8 TRCN0000358794 GATGATCAAGTCCCTTATAAG pLKO_005 2801 3UTR 100% 13.200 7.920 N TLR2 n/a
9 TRCN0000057020 CCTTGTTTACTTTCACAACAT pLKO.1 1182 CDS 100% 4.950 2.970 N TLR2 n/a
10 TRCN0000164978 GTGGTGGCTTATGCCTGTAAT pLKO.1 5024 3UTR 100% 13.200 6.600 Y C9orf139 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5036 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532216.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07074 pDONR223 100% 99.9% 100% None 597T>C n/a
2 ccsbBroad304_07074 pLX_304 0% 99.9% 100% V5 597T>C n/a
3 TRCN0000471496 TTGACCCATGTAATCCAAAATCCT pLX_317 21.8% 99.9% 100% V5 597T>C n/a
Download CSV