Transcript: Human XM_011532385.1

PREDICTED: Homo sapiens carbonyl reductase 4 (CBR4), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CBR4 (84869)
Length:
3334
CDS:
196..774

Additional Resources:

NCBI RefSeq record:
XM_011532385.1
NBCI Gene record:
CBR4 (84869)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532385.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234666 GGTAAATGCAGCTGGTATTAA pLKO_005 435 CDS 100% 15.000 21.000 N CBR4 n/a
2 TRCN0000046398 GCGGAGATCATTTGGCATTTA pLKO.1 335 CDS 100% 13.200 18.480 N CBR4 n/a
3 TRCN0000046399 CCGTATATTACAGGGCATGTT pLKO.1 718 CDS 100% 4.950 6.930 N CBR4 n/a
4 TRCN0000234668 CCCACTAAAGATAACTATATT pLKO_005 1364 3UTR 100% 15.000 10.500 N CBR4 n/a
5 TRCN0000234664 CAGAGCTGTGGCCCAGTTAAT pLKO_005 240 CDS 100% 13.200 9.240 N CBR4 n/a
6 TRCN0000234665 TGACCTCGGCGGAGATCATTT pLKO_005 327 CDS 100% 13.200 9.240 N CBR4 n/a
7 TRCN0000046401 GCTGCCATGAGGACTATGATT pLKO.1 544 CDS 100% 5.625 3.938 N CBR4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532385.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04435 pDONR223 100% 81% 81% None 398_399ins135 n/a
2 ccsbBroad304_04435 pLX_304 0% 81% 81% V5 398_399ins135 n/a
3 TRCN0000474263 TACTCCCTCTCAGTCCGGCTGGTA pLX_317 79.7% 81% 81% V5 398_399ins135 n/a
4 ccsbBroadEn_09231 pDONR223 100% 80.8% 80.5% None 208C>A;398_399ins135 n/a
5 ccsbBroad304_09231 pLX_304 0% 80.8% 80.5% V5 208C>A;398_399ins135 n/a
6 TRCN0000470562 TTGTAGATAGGATCATCGACATTA pLX_317 51.8% 80.8% 80.5% V5 208C>A;398_399ins135 n/a
Download CSV