Transcript: Human XM_011532415.3

PREDICTED: Homo sapiens N-deacetylase and N-sulfotransferase 3 (NDST3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NDST3 (9348)
Length:
2403
CDS:
372..1946

Additional Resources:

NCBI RefSeq record:
XM_011532415.3
NBCI Gene record:
NDST3 (9348)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532415.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427530 ATCGAAGCCTTCTAGATAAAT pLKO_005 808 CDS 100% 15.000 21.000 N NDST3 n/a
2 TRCN0000035992 GCGTGCACAAATCACAAATTT pLKO.1 1379 CDS 100% 15.000 12.000 N NDST3 n/a
3 TRCN0000415588 GACCTCCAACACCTACCATAT pLKO_005 531 CDS 100% 10.800 7.560 N NDST3 n/a
4 TRCN0000035989 CCCACAGTCCTAGTATTTGTA pLKO.1 603 CDS 100% 5.625 3.938 N NDST3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532415.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07396 pDONR223 100% 59.7% 58.8% None (many diffs) n/a
2 ccsbBroad304_07396 pLX_304 0% 59.7% 58.8% V5 (many diffs) n/a
3 TRCN0000491282 ACGTAGTCCTAAACAGAATCCTGA pLX_317 10.9% 59.7% 58.8% V5 (many diffs) n/a
Download CSV