Transcript: Human XM_011532492.2

PREDICTED: Homo sapiens adenylate cyclase 3 (ADCY3), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADCY3 (109)
Length:
4640
CDS:
249..3701

Additional Resources:

NCBI RefSeq record:
XM_011532492.2
NBCI Gene record:
ADCY3 (109)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532492.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420178 AGAGTCCGCCCAAGTAGTAAA pLKO_005 2162 CDS 100% 13.200 18.480 N ADCY3 n/a
2 TRCN0000078337 GTCTGCGTTTCCTCAATGAAA pLKO.1 3217 CDS 100% 5.625 7.875 N ADCY3 n/a
3 TRCN0000078333 CCCTTAGTCATGAGAACAGAA pLKO.1 4390 3UTR 100% 4.950 6.930 N ADCY3 n/a
4 TRCN0000078334 GCGTCCCGTCTTTGATGAATA pLKO.1 2756 CDS 100% 13.200 9.240 N ADCY3 n/a
5 TRCN0000418708 ACCTAGAAGAGAAGGGTATTG pLKO_005 1756 CDS 100% 10.800 7.560 N ADCY3 n/a
6 TRCN0000427265 GTGCCTTCCAAGTACTCTATG pLKO_005 2880 CDS 100% 10.800 7.560 N ADCY3 n/a
7 TRCN0000078335 CCCTGGCTAATGACAAACTAT pLKO.1 2334 CDS 100% 5.625 3.938 N ADCY3 n/a
8 TRCN0000078336 GCAGTTCAACACCATGTACAT pLKO.1 1163 CDS 100% 4.950 3.465 N ADCY3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532492.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00024 pDONR223 100% 92.6% 90.7% None (many diffs) n/a
2 ccsbBroad304_00024 pLX_304 0% 92.6% 90.7% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV