Transcript: Human XM_011532557.2

PREDICTED: Homo sapiens catenin alpha 2 (CTNNA2), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CTNNA2 (1496)
Length:
2642
CDS:
216..1730

Additional Resources:

NCBI RefSeq record:
XM_011532557.2
NBCI Gene record:
CTNNA2 (1496)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532557.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435394 GTTCGCATTGGCGCAATATTT pLKO_005 1989 3UTR 100% 15.000 21.000 N CTNNA2 n/a
2 TRCN0000421543 TGTACTAGCCAATACGCTTAA pLKO_005 2169 3UTR 100% 10.800 15.120 N CTNNA2 n/a
3 TRCN0000412374 TAAGATGAGATGAGATCAATA pLKO_005 1869 3UTR 100% 13.200 9.240 N CTNNA2 n/a
4 TRCN0000148903 CCAGAAGAACTAGAGGATGAT pLKO.1 765 CDS 100% 4.950 3.465 N CTNNA2 n/a
5 TRCN0000147992 GAGGTAGATTGTGATGTCATA pLKO.1 1332 CDS 100% 4.950 3.465 N CTNNA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532557.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06063 pDONR223 100% 47.8% 47.8% None 0_1ins1347;585G>A;1083_1226del n/a
2 ccsbBroad304_06063 pLX_304 0% 47.8% 47.8% V5 0_1ins1347;585G>A;1083_1226del n/a
Download CSV