Transcript: Human XM_011532705.2

PREDICTED: Homo sapiens proteasome activator subunit 4 (PSME4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PSME4 (23198)
Length:
7133
CDS:
15..5624

Additional Resources:

NCBI RefSeq record:
XM_011532705.2
NBCI Gene record:
PSME4 (23198)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532705.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417644 GCGCTGGCTGAACAAGTTAAT pLKO_005 1121 CDS 100% 13.200 18.480 N PSME4 n/a
2 TRCN0000429193 GTAGATGCATGTCGACTTTAT pLKO_005 4458 CDS 100% 13.200 18.480 N PSME4 n/a
3 TRCN0000422000 TATCAGGTGGCTGGTTATAAG pLKO_005 5135 CDS 100% 13.200 10.560 N PSME4 n/a
4 TRCN0000152425 CGATTGTTTCTTCAGGGCTTA pLKO.1 3244 CDS 100% 4.050 3.240 N PSME4 n/a
5 TRCN0000152939 GCTTCTCAGTTGCCATTTGAT pLKO.1 5782 3UTR 100% 5.625 3.938 N PSME4 n/a
6 TRCN0000158223 CCCTGAGTTTACTGCTCGAAT pLKO.1 4670 CDS 100% 4.950 3.465 N PSME4 n/a
7 TRCN0000151447 CGGAATTACTTCAACAGTCAA pLKO.1 3391 CDS 100% 4.950 3.465 N PSME4 n/a
8 TRCN0000156489 CGGTTGCCAAACAGTGTTGTT pLKO.1 1155 CDS 100% 4.950 3.465 N PSME4 n/a
9 TRCN0000153347 GCAGAATCGTTGAGAGACTAA pLKO.1 6490 3UTR 100% 4.950 3.465 N PSME4 n/a
10 TRCN0000157072 GCTGCTGGATTTAGGTGGTAA pLKO.1 6036 3UTR 100% 4.950 3.465 N PSME4 n/a
11 TRCN0000157835 CCTCATCAAGTGCCTTTGGTA pLKO.1 4986 CDS 100% 3.000 2.100 N PSME4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532705.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15751 pDONR223 0% 11.5% 11.5% None 1_4950del;5329_5340del n/a
2 ccsbBroad304_15751 pLX_304 0% 11.5% 11.5% V5 1_4950del;5329_5340del n/a
3 TRCN0000474718 ATAGGCCCGGCGTTACGGTCCACG pLX_317 61.3% 11.5% 11.5% V5 1_4950del;5329_5340del n/a
Download CSV