Transcript: Human XM_011532728.2

PREDICTED: Homo sapiens ras homolog family member Q (RHOQ), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RHOQ (23433)
Length:
2541
CDS:
30..503

Additional Resources:

NCBI RefSeq record:
XM_011532728.2
NBCI Gene record:
RHOQ (23433)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532728.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047590 CCTACTCATGAGCTATGCCAA pLKO.1 16 5UTR 100% 2.640 3.696 N RHOQ n/a
2 TRCN0000308154 TCTGAAGCCACAATCTATTAT pLKO_005 692 3UTR 100% 15.000 10.500 N RHOQ n/a
3 TRCN0000047588 GCAAGACTGAATGATATGAAA pLKO.1 282 CDS 100% 5.625 3.938 N RHOQ n/a
4 TRCN0000289569 GCAAGACTGAATGATATGAAA pLKO_005 282 CDS 100% 5.625 3.938 N RHOQ n/a
5 TRCN0000047592 ACTCAGATTGATCTCCGAGAT pLKO.1 246 CDS 100% 4.050 2.835 N RHOQ n/a
6 TRCN0000289570 ACTCAGATTGATCTCCGAGAT pLKO_005 246 CDS 100% 4.050 2.835 N RHOQ n/a
7 TRCN0000047589 CGGTGGTAAATCCAGCCTCAT pLKO.1 151 CDS 100% 4.050 2.835 N RHOQ n/a
8 TRCN0000047591 GAGGCCTTTATCTTACCCAAT pLKO.1 104 CDS 100% 4.050 2.430 N RHOQ n/a
9 TRCN0000289568 GAGGCCTTTATCTTACCCAAT pLKO_005 104 CDS 100% 4.050 2.430 N RHOQ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532728.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02767 pDONR223 100% 76.5% 68.7% None 0_1ins85;54_55ins59 n/a
2 ccsbBroad304_02767 pLX_304 0% 76.5% 68.7% V5 0_1ins85;54_55ins59 n/a
3 TRCN0000468701 ATATGACCATCACTCATCACCCGG pLX_317 66.1% 76.5% 68.7% V5 0_1ins85;54_55ins59 n/a
Download CSV