Transcript: Human XM_011532750.3

PREDICTED: Homo sapiens ventral anterior homeobox 2 (VAX2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VAX2 (25806)
Length:
3125
CDS:
72..524

Additional Resources:

NCBI RefSeq record:
XM_011532750.3
NBCI Gene record:
VAX2 (25806)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532750.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422518 AGCGGACACGTACATCCTTCA pLKO_005 379 CDS 100% 4.050 5.670 N VAX2 n/a
2 TRCN0000016601 CGCCGCATACTGGTGCGAGAT pLKO.1 300 CDS 100% 0.000 0.000 N VAX2 n/a
3 TRCN0000016600 CCAAAGGGACAATTCGGGAAA pLKO.1 322 CDS 100% 4.050 2.835 N VAX2 n/a
4 TRCN0000016602 TCGGGAAATTGTCCTGCCTAA pLKO.1 335 CDS 100% 4.050 2.835 N VAX2 n/a
5 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2860 3UTR 100% 13.200 6.600 Y LIAS n/a
6 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 2935 3UTR 100% 4.950 2.475 Y ORAI2 n/a
7 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 2932 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532750.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02858 pDONR223 100% 51% 50.6% None (many diffs) n/a
2 ccsbBroad304_02858 pLX_304 0% 51% 50.6% V5 (many diffs) n/a
3 TRCN0000467981 TCTAACTCTTCCACCTCCAGACAA pLX_317 38.6% 51% 50.6% V5 (many diffs) n/a
Download CSV