Transcript: Human XM_011533113.3

PREDICTED: Homo sapiens calmodulin-lysine N-methyltransferase (CAMKMT), transcript variant X24, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CAMKMT (79823)
Length:
1231
CDS:
249..752

Additional Resources:

NCBI RefSeq record:
XM_011533113.3
NBCI Gene record:
CAMKMT (79823)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533113.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148644 CGATGGGATAATGAGACAGAT pLKO.1 411 CDS 100% 4.950 3.960 N CAMKMT n/a
2 TRCN0000129144 GCCTGTCTGTGACTTGAATTT pLKO.1 1008 3UTR 100% 13.200 9.240 N CAMKMT n/a
3 TRCN0000150045 CTGTTAACTGATGGGAATGAA pLKO.1 303 CDS 100% 5.625 3.938 N CAMKMT n/a
4 TRCN0000146916 CCCTAAACCTTTGTTTGTCTT pLKO.1 971 3UTR 100% 4.950 3.465 N CAMKMT n/a
5 TRCN0000150140 GACTTGAATTTGACTGGTGAA pLKO.1 1018 3UTR 100% 4.050 2.835 N CAMKMT n/a
6 TRCN0000129525 GTCTCTCAACTGGAAGGACAT pLKO.1 432 CDS 100% 4.050 2.835 N CAMKMT n/a
7 TRCN0000148319 CCATCAGAAATGTGCAAGACA pLKO.1 328 CDS 100% 3.000 2.100 N CAMKMT n/a
8 TRCN0000129944 GAAGAAACGTATCAAGTGCAT pLKO.1 774 3UTR 100% 2.640 1.848 N CAMKMT n/a
9 TRCN0000130103 CTACTGCCTCAAGCACAATAA pLKO.1 188 5UTR 100% 13.200 6.600 Y CAMKMT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533113.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08965 pDONR223 100% 51.5% 51.3% None 0_1ins468;157G>T n/a
2 ccsbBroad304_08965 pLX_304 0% 51.5% 51.3% V5 0_1ins468;157G>T n/a
3 TRCN0000469789 GGCCGAATCTCGTCAGTGTGCGTT pLX_317 41.6% 51.5% 51.3% V5 0_1ins468;157G>T n/a
Download CSV