Transcript: Human XM_011533164.2

PREDICTED: Homo sapiens CD8b molecule (CD8B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CD8B (926)
Length:
4848
CDS:
18..758

Additional Resources:

NCBI RefSeq record:
XM_011533164.2
NBCI Gene record:
CD8B (926)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533164.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057511 CCTCAGTAACATGCGCATCTA pLKO.1 155 CDS 100% 4.950 2.970 N CD8B n/a
2 TRCN0000371762 TCAGCTGAGTGTGGTTGATTT pLKO_005 407 CDS 100% 13.200 6.600 Y CD8B n/a
3 TRCN0000371712 CCTGGTAGGGCAGTAACATTG pLKO_005 1065 3UTR 100% 10.800 5.400 Y CD8B n/a
4 TRCN0000166498 CGCCTGTAATCCCAGTACTTT pLKO.1 4233 3UTR 100% 5.625 2.813 Y MGC13053 n/a
5 TRCN0000057508 GCTGGAGGACTGAGTAAGAAA pLKO.1 949 3UTR 100% 5.625 2.813 Y CD8B n/a
6 TRCN0000057512 GCAAGCCGGTTCATTCTCAAT pLKO.1 303 CDS 100% 4.950 2.475 Y CD8B n/a
7 TRCN0000180418 GATCACTTGAGCTCAGGAGTT pLKO.1 4272 3UTR 100% 4.050 2.025 Y ERN2 n/a
8 TRCN0000057509 CCTGCATACATAAAGGTGCAA pLKO.1 93 CDS 100% 2.640 1.320 Y CD8B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533164.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05956 pDONR223 100% 87.9% 85.3% None (many diffs) n/a
2 ccsbBroad304_05956 pLX_304 0% 87.9% 85.3% V5 (many diffs) n/a
3 TRCN0000466988 TTTGATACTTCGTTTTAAGAATTT pLX_317 48.5% 87.9% 85.3% V5 (many diffs) n/a
Download CSV