Transcript: Human XM_011533242.3

PREDICTED: Homo sapiens MKRN2 opposite strand (MKRN2OS), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MKRN2OS (100129480)
Length:
1650
CDS:
274..588

Additional Resources:

NCBI RefSeq record:
XM_011533242.3
NBCI Gene record:
MKRN2OS (100129480)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533242.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 716 3UTR 100% 4.950 2.475 Y CFLAR n/a
2 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 716 3UTR 100% 4.950 2.475 Y C19orf31 n/a
3 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 1406 3UTR 100% 4.050 2.025 Y P3H4 n/a
4 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 1406 3UTR 100% 4.050 2.025 Y ORAI2 n/a
5 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 1406 3UTR 100% 4.050 2.025 Y P3H4 n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 36 5UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 714 3UTR 100% 4.950 2.475 Y ERN2 n/a
8 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 714 3UTR 100% 4.950 2.475 Y P3H4 n/a
9 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 714 3UTR 100% 4.950 2.475 Y P3H4 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 36 5UTR 100% 5.625 2.813 Y EID2B n/a
11 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 882 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533242.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.