Transcript: Human XM_011533329.2

PREDICTED: Homo sapiens cytokine inducible SH2 containing protein (CISH), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CISH (1154)
Length:
4933
CDS:
2986..3780

Additional Resources:

NCBI RefSeq record:
XM_011533329.2
NBCI Gene record:
CISH (1154)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533329.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232981 TCGGGAATCTGGCTGGTATTG pLKO_005 3234 CDS 100% 10.800 15.120 N CISH n/a
2 TRCN0000056694 CCACCAATGTACGCATTGAGT pLKO.1 3380 CDS 100% 0.300 0.420 N CISH n/a
3 TRCN0000056696 CCTGCACTGCTGATACCCGAA pLKO.1 3500 CDS 100% 0.720 0.576 N CISH n/a
4 TRCN0000056693 GCACGTTCTTAGTACGTGACA pLKO.1 3308 CDS 100% 0.264 0.211 N CISH n/a
5 TRCN0000232984 CTGCACAATTATACACTATTT pLKO_005 4256 3UTR 100% 13.200 9.240 N CISH n/a
6 TRCN0000232982 TGCCAGAAGGCACGTTCTTAG pLKO_005 3299 CDS 100% 10.800 7.560 N CISH n/a
7 TRCN0000232980 CAGACAGAGAGTGAGCCAAAG pLKO_005 3160 CDS 100% 6.000 4.200 N CISH n/a
8 TRCN0000056695 GCTGTGCATAGCCAAGACCTT pLKO.1 3204 CDS 100% 2.640 1.848 N CISH n/a
9 TRCN0000056697 CCTTCGGGAATCTGGCTGGTA pLKO.1 3231 CDS 100% 0.880 0.616 N CISH n/a
10 TRCN0000232983 AGCCACTGCTGTACACCTAAA pLKO_005 3609 CDS 100% 10.800 6.480 N CISH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533329.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06007 pDONR223 100% 96.7% 93.6% None (many diffs) n/a
2 ccsbBroad304_06007 pLX_304 0% 96.7% 93.6% V5 (many diffs) n/a
3 TRCN0000473621 CTACGGTGTAACCGCTGGTACTCG pLX_317 67.3% 96.7% 93.6% V5 (many diffs) n/a
Download CSV