Transcript: Human XM_011533332.3

PREDICTED: Homo sapiens leucine rich repeat containing 3B (LRRC3B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRRC3B (116135)
Length:
6908
CDS:
439..1218

Additional Resources:

NCBI RefSeq record:
XM_011533332.3
NBCI Gene record:
LRRC3B (116135)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533332.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161222 GACCTTTGTAACCTCCCTAAA pLKO.1 1015 CDS 100% 10.800 15.120 N LRRC3B n/a
2 TRCN0000431246 GTCCGACAATCGGATTCAAAG pLKO_005 798 CDS 100% 10.800 15.120 N LRRC3B n/a
3 TRCN0000430035 TCCAATCAGATCACATCTATT pLKO_005 655 CDS 100% 13.200 9.240 N LRRC3B n/a
4 TRCN0000432475 ATGTTTGGCTGGTTCACTATG pLKO_005 1066 CDS 100% 10.800 7.560 N LRRC3B n/a
5 TRCN0000158863 GCAGTAGAAATAAGTGGTTTA pLKO.1 1266 3UTR 100% 10.800 7.560 N LRRC3B n/a
6 TRCN0000160914 GTCACCTGTAGCAATGCAAAT pLKO.1 580 CDS 100% 10.800 7.560 N LRRC3B n/a
7 TRCN0000160613 CTGACTGTCATTGAGAAAGAA pLKO.1 1227 3UTR 100% 5.625 3.938 N LRRC3B n/a
8 TRCN0000160392 CTTATGATACTGTGCTTTCAT pLKO.1 505 CDS 100% 5.625 3.938 N LRRC3B n/a
9 TRCN0000160168 CCTGAAACAGTCTTACTGTAT pLKO.1 628 CDS 100% 4.950 3.465 N LRRC3B n/a
10 TRCN0000160855 GACTGTACTCTACAGCAAGTT pLKO.1 886 CDS 100% 4.950 3.465 N LRRC3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533332.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04694 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04694 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472627 CGCACGTTAAAGCATAACTCTCAC pLX_317 58.5% 100% 100% V5 n/a
Download CSV