Transcript: Human XM_011533478.2

PREDICTED: Homo sapiens 5'-aminolevulinate synthase 1 (ALAS1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ALAS1 (211)
Length:
2235
CDS:
280..2088

Additional Resources:

NCBI RefSeq record:
XM_011533478.2
NBCI Gene record:
ALAS1 (211)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533478.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045741 CCCAAGATTGTGGCATTTGAA pLKO.1 1456 CDS 100% 5.625 3.938 N ALAS1 n/a
2 TRCN0000290717 CCCAAGATTGTGGCATTTGAA pLKO_005 1456 CDS 100% 5.625 3.938 N ALAS1 n/a
3 TRCN0000045738 GCAGTTATGGACACTTTGAAA pLKO.1 1123 CDS 100% 5.625 3.938 N ALAS1 n/a
4 TRCN0000290719 GCAGTTATGGACACTTTGAAA pLKO_005 1123 CDS 100% 5.625 3.938 N ALAS1 n/a
5 TRCN0000045740 CCAGAAAGAGTGTCTCATCTT pLKO.1 865 CDS 100% 4.950 3.465 N ALAS1 n/a
6 TRCN0000290785 CCAGAAAGAGTGTCTCATCTT pLKO_005 865 CDS 100% 4.950 3.465 N ALAS1 n/a
7 TRCN0000045742 CCGAGTGCCAAAGTACATCTT pLKO.1 1377 CDS 100% 4.950 3.465 N ALAS1 n/a
8 TRCN0000307238 CCGAGTGCCAAAGTACATCTT pLKO_005 1377 CDS 100% 4.950 3.465 N ALAS1 n/a
9 TRCN0000045739 GCTGTGAGATTTACTCTGATT pLKO.1 1316 CDS 100% 4.950 3.465 N ALAS1 n/a
10 TRCN0000290718 GCTGTGAGATTTACTCTGATT pLKO_005 1316 CDS 100% 4.950 3.465 N ALAS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533478.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05798 pDONR223 100% 88.9% 88.8% None (many diffs) n/a
2 ccsbBroad304_05798 pLX_304 0% 88.9% 88.8% V5 (many diffs) n/a
3 TRCN0000492066 AGGCCGAGACGGCTCGGATACTAA pLX_317 16.5% 88.9% 88.8% V5 (many diffs) n/a
Download CSV