Transcript: Human XM_011533826.3

PREDICTED: Homo sapiens PHD finger protein 7 (PHF7), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHF7 (51533)
Length:
1555
CDS:
694..1503

Additional Resources:

NCBI RefSeq record:
XM_011533826.3
NBCI Gene record:
PHF7 (51533)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533826.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358521 CAATATCAGCGTGCATTATTT pLKO_005 852 CDS 100% 15.000 21.000 N PHF7 n/a
2 TRCN0000016795 CCGCAAGTGCATACAGAAATA pLKO.1 1251 CDS 100% 13.200 18.480 N PHF7 n/a
3 TRCN0000016796 AGACAATATCAGCGTGCATTA pLKO.1 849 CDS 100% 10.800 15.120 N PHF7 n/a
4 TRCN0000358484 TGTCTTATCTTATCTAGTAAG pLKO_005 874 CDS 100% 10.800 7.560 N PHF7 n/a
5 TRCN0000016794 CCCATCTGTCTGTATGAACAA pLKO.1 1444 CDS 100% 4.950 3.465 N PHF7 n/a
6 TRCN0000016793 CCCACACATCAGCAAAGCATT pLKO.1 1274 CDS 100% 4.950 2.970 N PHF7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533826.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08309 pDONR223 100% 70.4% 69.8% None (many diffs) n/a
2 ccsbBroad304_08309 pLX_304 0% 70.4% 69.8% V5 (many diffs) n/a
3 TRCN0000466092 GTCCATGTACCTGACATATATCTT pLX_317 31.7% 70.4% 69.8% V5 (many diffs) n/a
Download CSV