Transcript: Human XM_011533856.3

PREDICTED: Homo sapiens elongator acetyltransferase complex subunit 6 (ELP6), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ELP6 (54859)
Length:
2559
CDS:
225..998

Additional Resources:

NCBI RefSeq record:
XM_011533856.3
NBCI Gene record:
ELP6 (54859)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533856.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330149 CACCGTGTGCTGGGAACTAAA pLKO_005 581 CDS 100% 13.200 9.240 N ELP6 n/a
2 TRCN0000129149 GAAACTGACTCTACTCTGTGA pLKO.1 205 5UTR 100% 2.640 1.848 N ELP6 n/a
3 TRCN0000330075 GAAACTGACTCTACTCTGTGA pLKO_005 205 5UTR 100% 2.640 1.848 N ELP6 n/a
4 TRCN0000128508 CTTTCTCTCCTTCTATCTCAA pLKO.1 259 CDS 100% 4.950 2.475 Y ELP6 n/a
5 TRCN0000330148 CTTTCTCTCCTTCTATCTCAA pLKO_005 259 CDS 100% 4.950 2.475 Y ELP6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533856.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12098 pDONR223 100% 55.2% 37.3% None (many diffs) n/a
2 ccsbBroad304_12098 pLX_304 0% 55.2% 37.3% V5 (many diffs) n/a
3 TRCN0000473103 TGAACCACAAAAGTACATTAGCAA pLX_317 60.1% 55.2% 37.3% V5 (many diffs) n/a
Download CSV