Transcript: Human XM_011533937.2

PREDICTED: Homo sapiens transmembrane protein 40 (TMEM40), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM40 (55287)
Length:
1223
CDS:
383..1084

Additional Resources:

NCBI RefSeq record:
XM_011533937.2
NBCI Gene record:
TMEM40 (55287)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533937.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257047 GAAACCGTTGGCATCTACTTC pLKO_005 974 CDS 100% 4.950 6.930 N TMEM40 n/a
2 TRCN0000244586 CAGTTAAGAAGACTGAATATA pLKO_005 824 CDS 100% 15.000 10.500 N TMEM40 n/a
3 TRCN0000244588 GCTGGTGTGTTATCACTATTA pLKO_005 901 CDS 100% 13.200 9.240 N TMEM40 n/a
4 TRCN0000244589 AGGATGAGCTTCAACTCTATG pLKO_005 714 CDS 100% 10.800 7.560 N TMEM40 n/a
5 TRCN0000172946 GCAGACTGGTTCATGTCTCTT pLKO.1 923 CDS 100% 4.950 3.465 N TMEM40 n/a
6 TRCN0000168682 GAGCTTCAACTCTATGGAGAT pLKO.1 719 CDS 100% 4.050 2.835 N TMEM40 n/a
7 TRCN0000176441 CCTCTCAGTTAAGAAGACTGA pLKO.1 819 CDS 100% 0.264 0.185 N Tmem40 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533937.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12199 pDONR223 100% 87.1% 87.1% None 211_300del n/a
2 ccsbBroad304_12199 pLX_304 0% 87.1% 87.1% V5 211_300del n/a
3 TRCN0000474604 AGAAGAAAATGCAGTGCTGTTGTC pLX_317 51.8% 87.1% 87.1% V5 211_300del n/a
Download CSV