Transcript: Human XM_011534123.2

PREDICTED: Homo sapiens zinc finger protein 385D (ZNF385D), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF385D (79750)
Length:
1084
CDS:
87..914

Additional Resources:

NCBI RefSeq record:
XM_011534123.2
NBCI Gene record:
ZNF385D (79750)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534123.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430133 CGATTCAGAAAGCTGTAATAA pLKO_005 562 CDS 100% 15.000 21.000 N ZNF385D n/a
2 TRCN0000414889 ACCGAAGAAAGCAAATCATAT pLKO_005 610 CDS 100% 13.200 9.240 N ZNF385D n/a
3 TRCN0000138157 CTTTGCAACCATCGCTGGATA pLKO.1 466 CDS 100% 4.950 3.465 N ZNF385D n/a
4 TRCN0000138641 CAAAGGCACGAAACATGCCAA pLKO.1 686 CDS 100% 2.640 1.848 N ZNF385D n/a
5 TRCN0000135426 GCAGAAATCTGTAACTGCCAA pLKO.1 740 CDS 100% 2.640 1.848 N ZNF385D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534123.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10467 pDONR223 100% 33.5% 29.3% None (many diffs) n/a
2 ccsbBroad304_10467 pLX_304 0% 33.5% 29.3% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV