Transcript: Human XM_011534325.3

PREDICTED: Homo sapiens xylulokinase (XYLB), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
XYLB (9942)
Length:
2789
CDS:
75..2546

Additional Resources:

NCBI RefSeq record:
XM_011534325.3
NBCI Gene record:
XYLB (9942)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534325.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037932 GCCAGCAACACGGAAGTATAT pLKO.1 361 CDS 100% 13.200 18.480 N XYLB n/a
2 TRCN0000194902 CGTCATAGGTTTAACACAGAA pLKO.1 1239 CDS 100% 4.950 6.930 N XYLB n/a
3 TRCN0000037929 CGAGCACTAATTGAAGGACAA pLKO.1 1299 CDS 100% 4.050 5.670 N XYLB n/a
4 TRCN0000194852 CCGGTGTATGTTATAGACACT pLKO.1 1449 CDS 100% 2.640 3.696 N XYLB n/a
5 TRCN0000438011 GCAGGCACTGACAAGCTTATC pLKO_005 401 CDS 100% 10.800 8.640 N XYLB n/a
6 TRCN0000037933 GTTGTGAAGTTAGCTCCAAAT pLKO.1 1548 CDS 100% 10.800 8.640 N XYLB n/a
7 TRCN0000196999 GTGGAGGTTCGAGCACTAATT pLKO.1 1290 CDS 100% 13.200 9.240 N XYLB n/a
8 TRCN0000444928 CTCAGTTGTGGGAGCCATTTC pLKO_005 830 CDS 100% 10.800 7.560 N XYLB n/a
9 TRCN0000440012 TACGTCCAGCGCTACGGATTT pLKO_005 858 CDS 100% 10.800 7.560 N XYLB n/a
10 TRCN0000037930 GCAGAGTTGAATGTCTTCTAT pLKO.1 153 CDS 100% 5.625 3.938 N XYLB n/a
11 TRCN0000416217 CCTACTCACATACGGAGAGAA pLKO_005 631 CDS 100% 4.950 3.465 N XYLB n/a
12 TRCN0000037931 CCTGAAATTATTGGACGTCAT pLKO.1 1224 CDS 100% 4.050 2.835 N XYLB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534325.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14948 pDONR223 0% 55.9% 55.2% None (many diffs) n/a
2 ccsbBroad304_14948 pLX_304 0% 55.9% 55.2% V5 (many diffs) n/a
3 TRCN0000471651 GACTCCCGATTGTTCTTCAGTTCC pLX_317 31% 55.9% 55.2% V5 (many diffs) n/a
Download CSV