Transcript: Human XM_011534382.2

PREDICTED: Homo sapiens cysteine rich hydrophobic domain 2 (CHIC2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHIC2 (26511)
Length:
884
CDS:
349..744

Additional Resources:

NCBI RefSeq record:
XM_011534382.2
NBCI Gene record:
CHIC2 (26511)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534382.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312636 TCCGGTCACGTCACCGTATTT pLKO_005 451 CDS 100% 13.200 18.480 N CHIC2 n/a
2 TRCN0000118909 CCTGTTAATGTACGTTGGCTA pLKO.1 586 CDS 100% 2.640 3.696 N CHIC2 n/a
3 TRCN0000369847 AGTAGCTCCTGAAGAATTTAA pLKO_005 522 CDS 100% 15.000 10.500 N CHIC2 n/a
4 TRCN0000369920 CAGAGTTAACAGTTGTCTTAA pLKO_005 555 CDS 100% 13.200 9.240 N CHIC2 n/a
5 TRCN0000174918 GTATTTGGACTGAGCAACAAA pLKO.1 466 CDS 100% 5.625 3.938 N Chic2 n/a
6 TRCN0000320178 GTATTTGGACTGAGCAACAAA pLKO_005 466 CDS 100% 5.625 3.938 N Chic2 n/a
7 TRCN0000118908 GCCAGTTATTTGCCTCAGTAA pLKO.1 654 CDS 100% 4.950 3.465 N CHIC2 n/a
8 TRCN0000118910 GCTGCACATTAGGTTGCAGTA pLKO.1 629 CDS 100% 0.405 0.284 N CHIC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534382.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08021 pDONR223 100% 71.7% 67.8% None (many diffs) n/a
2 ccsbBroad304_08021 pLX_304 0% 71.7% 67.8% V5 (many diffs) n/a
3 TRCN0000491711 ACGCAACTAACCGCTGTTCTTTCG pLX_317 68.1% 71.7% 67.8% V5 (many diffs) n/a
Download CSV