Transcript: Human XM_011534531.3

PREDICTED: Homo sapiens ADP ribosylation factor like GTPase 10 (ARL10), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARL10 (285598)
Length:
3158
CDS:
63..650

Additional Resources:

NCBI RefSeq record:
XM_011534531.3
NBCI Gene record:
ARL10 (285598)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534531.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146958 CCACTAAATCAACAACCACAA pLKO.1 1800 3UTR 100% 4.050 2.835 N ARL10 n/a
2 TRCN0000180122 CCAGAGTTCTAGGCTCTGTTT pLKO.1 1225 3UTR 100% 0.495 0.347 N ARL10 n/a
3 TRCN0000148897 CCCAGATGACAGTCATAGAAA pLKO.1 1266 3UTR 100% 5.625 3.375 N ARL10 n/a
4 TRCN0000426160 GAAACAGTCTGGTGACGTCAT pLKO_005 692 3UTR 100% 4.050 2.430 N ARL10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534531.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14465 pDONR223 100% 69.5% 15.2% None (many diffs) n/a
2 ccsbBroad304_14465 pLX_304 0% 69.5% 15.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000476964 CTACCTTGACCGTGTAACTAGACT pLX_317 44.4% 69.5% 15.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV