Transcript: Human XM_011534660.2

PREDICTED: Homo sapiens cytoplasmic polyadenylation element binding protein 4 (CPEB4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CPEB4 (80315)
Length:
2800
CDS:
1407..2726

Additional Resources:

NCBI RefSeq record:
XM_011534660.2
NBCI Gene record:
CPEB4 (80315)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534660.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153850 CCGATAGCTCTCTGCTTATTA pLKO.1 2641 CDS 100% 15.000 21.000 N CPEB4 n/a
2 TRCN0000151922 CGATAGCTCTCTGCTTATTAA pLKO.1 2642 CDS 100% 15.000 21.000 N CPEB4 n/a
3 TRCN0000256164 TACCATTAAAGGTCGTCTAAA pLKO_005 2603 CDS 100% 0.000 0.000 N CPEB4 n/a
4 TRCN0000256162 AGAGTTCACTCATTGACATAA pLKO_005 2566 CDS 100% 13.200 9.240 N CPEB4 n/a
5 TRCN0000156565 GCTGCCTCATTTGGCGAATAA pLKO.1 2216 CDS 100% 13.200 9.240 N CPEB4 n/a
6 TRCN0000256161 TCCCTGCTGCTTCGGCTAATA pLKO_005 1990 CDS 100% 13.200 9.240 N CPEB4 n/a
7 TRCN0000158083 CCAGTGTTGACAGGGTTTGAT pLKO.1 1818 CDS 100% 5.625 3.938 N CPEB4 n/a
8 TRCN0000198916 GAAGCTGGAATACTGCCTGAA pLKO.1 1713 CDS 100% 4.050 2.835 N Cpeb4 n/a
9 TRCN0000152863 GCTACCCATAACATTCAGGAT pLKO.1 1602 CDS 100% 2.640 1.848 N CPEB4 n/a
10 TRCN0000177316 GCAAAGCAATACTGGGAATAA pLKO.1 1436 CDS 100% 13.200 7.920 N Cpeb4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534660.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.