Transcript: Human XM_011534690.2

PREDICTED: Homo sapiens collagen type XXIII alpha 1 chain (COL23A1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COL23A1 (91522)
Length:
2817
CDS:
89..1735

Additional Resources:

NCBI RefSeq record:
XM_011534690.2
NBCI Gene record:
COL23A1 (91522)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534690.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250114 GTTGGACGGACTAGCGAAGAT pLKO_005 385 CDS 100% 4.950 6.930 N COL23A1 n/a
2 TRCN0000250115 GGAAGCTCCATCCGAATGTGT pLKO_005 418 CDS 100% 3.000 4.200 N COL23A1 n/a
3 TRCN0000258013 ACACAGTGGTGATCGACTATG pLKO_005 948 CDS 100% 10.800 7.560 N COL23A1 n/a
4 TRCN0000250116 GGGTCTAGCTCTACCACATTC pLKO_005 2300 3UTR 100% 10.800 7.560 N COL23A1 n/a
5 TRCN0000250113 GAGCCAGGACTAGATGGTTTC pLKO_005 1460 CDS 100% 6.000 4.200 N COL23A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534690.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12959 pDONR223 100% 44.3% 36.4% None (many diffs) n/a
2 ccsbBroad304_12959 pLX_304 0% 44.3% 36.4% V5 (many diffs) n/a
3 TRCN0000468769 TGGATTTATTACCCTCACACCCTA pLX_317 44.8% 44.3% 36.4% V5 (many diffs) n/a
Download CSV