Transcript: Human XM_011534758.3

PREDICTED: Homo sapiens microcephalin 1 (MCPH1), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MCPH1 (79648)
Length:
3666
CDS:
54..2312

Additional Resources:

NCBI RefSeq record:
XM_011534758.3
NBCI Gene record:
MCPH1 (79648)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534758.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423827 ACACTTATCAAGCCTAATTAA pLKO_005 347 CDS 100% 15.000 10.500 N MCPH1 n/a
2 TRCN0000426642 GAAGTTGGAAGGATCCATTAA pLKO_005 800 CDS 100% 13.200 9.240 N MCPH1 n/a
3 TRCN0000083786 GAGACGTTTGAAGAGAAGTAT pLKO.1 1023 CDS 100% 5.625 3.938 N MCPH1 n/a
4 TRCN0000083784 GCAATGGAGAAGAGATTACAA pLKO.1 576 CDS 100% 5.625 3.938 N MCPH1 n/a
5 TRCN0000083785 GCCAACAAGAACATTAGTCAT pLKO.1 1988 CDS 100% 4.950 3.465 N MCPH1 n/a
6 TRCN0000083787 CGTAAATGTATGCAGCCCAAA pLKO.1 375 CDS 100% 4.050 2.835 N MCPH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534758.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12581 pDONR223 100% 68.2% 67.9% None (many diffs) n/a
2 ccsbBroad304_12581 pLX_304 0% 68.2% 67.9% V5 (many diffs) n/a
3 TRCN0000468585 TCAACCTCTCCTATCTTCTGCACC pLX_317 20.5% 68.2% 67.9% V5 (many diffs) n/a
Download CSV