Transcript: Human XM_011534787.3

PREDICTED: Homo sapiens ankyrin repeat and LEM domain containing 2 (ANKLE2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKLE2 (23141)
Length:
2043
CDS:
2..1948

Additional Resources:

NCBI RefSeq record:
XM_011534787.3
NBCI Gene record:
ANKLE2 (23141)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534787.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265459 GAGCGGATCAGAGAGTATTTA pLKO_005 1397 CDS 100% 15.000 10.500 N ANKLE2 n/a
2 TRCN0000254103 GTCACACCATTTGATTGTAAA pLKO_005 1297 CDS 100% 13.200 9.240 N ANKLE2 n/a
3 TRCN0000254257 CTATGACACACCGTTGCATTT pLKO_005 1234 CDS 100% 10.800 7.560 N ANKLE2 n/a
4 TRCN0000082059 CCTGGGTTGAATACTGGGAAT pLKO.1 1728 CDS 100% 4.050 2.835 N Ankle2 n/a
5 TRCN0000082062 CTGGGTTGAATACTGGGAATT pLKO.1 1729 CDS 100% 0.000 0.000 N Ankle2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534787.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07840 pDONR223 100% 68.1% 67.3% None (many diffs) n/a
2 ccsbBroad304_07840 pLX_304 0% 68.1% 67.3% V5 (many diffs) n/a
3 TRCN0000480366 TAAGGCCCGTCGTGCCAAAAAAGG pLX_317 12.9% 68.1% 67.3% V5 (many diffs) n/a
Download CSV