Transcript: Human XM_011534971.2

PREDICTED: Homo sapiens chibby family member 2 (CBY2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CBY2 (220082)
Length:
2976
CDS:
1362..2789

Additional Resources:

NCBI RefSeq record:
XM_011534971.2
NBCI Gene record:
CBY2 (220082)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534971.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160248 CAAGGCCAAATTATACAAGAA pLKO.1 1441 CDS 100% 4.950 3.960 N CBY2 n/a
2 TRCN0000161597 GAAATTCCAATCAGTGTGGTT pLKO.1 1488 CDS 100% 2.640 2.112 N CBY2 n/a
3 TRCN0000162340 CAGATCTGAAAGCCTAGAAAT pLKO.1 1472 CDS 100% 13.200 9.240 N CBY2 n/a
4 TRCN0000165196 GATGCTCAGCAAGGAGAACAA pLKO.1 2003 CDS 100% 4.950 3.465 N CBY2 n/a
5 TRCN0000163434 GAACAAGATCCTACAGGTCTT pLKO.1 2018 CDS 100% 4.050 2.835 N CBY2 n/a
6 TRCN0000165047 GCAACTCACATTGCACTCAAG pLKO.1 1424 CDS 100% 4.050 2.835 N CBY2 n/a
7 TRCN0000162718 CTGAAAGCCTAGAAATTCCAA pLKO.1 1477 CDS 100% 3.000 2.100 N CBY2 n/a
8 TRCN0000166138 CATAGGACCTATACCTGGCAA pLKO.1 1407 CDS 100% 2.640 1.848 N CBY2 n/a
9 TRCN0000166704 CCAATCAGTGTGGTTCTACCT pLKO.1 1494 CDS 100% 2.640 1.848 N CBY2 n/a
10 TRCN0000165524 GAACAACAAGCTGAAGCTGCA pLKO.1 2648 CDS 100% 2.160 1.512 N CBY2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534971.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13411 pDONR223 100% 86.7% 86.7% None 1_189del n/a
2 ccsbBroad304_13411 pLX_304 0% 86.7% 86.7% V5 1_189del n/a
3 TRCN0000468631 ATCTCTGTCTTTGTGCACACTGGG pLX_317 27.3% 86.7% 86.7% V5 1_189del n/a
Download CSV