Transcript: Human XM_011535022.2

PREDICTED: Homo sapiens microtubule associated scaffold protein 2 (MTUS2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MTUS2 (23281)
Length:
4589
CDS:
121..1848

Additional Resources:

NCBI RefSeq record:
XM_011535022.2
NBCI Gene record:
MTUS2 (23281)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535022.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147784 GCACCGATATGTGTGTATATT pLKO.1 2188 3UTR 100% 15.000 21.000 N MTUS2 n/a
2 TRCN0000130434 GCAAAGTGCGAGAAACTACAA pLKO.1 934 CDS 100% 4.950 6.930 N MTUS2 n/a
3 TRCN0000149753 GCTGTCAATCGAACTTGCAAA pLKO.1 885 CDS 100% 4.950 6.930 N MTUS2 n/a
4 TRCN0000129311 CGATTAAACTCTCGCCCACAT pLKO.1 1760 CDS 100% 4.050 5.670 N MTUS2 n/a
5 TRCN0000129063 GAAGACCTCAAAGCAAGGATT pLKO.1 1591 CDS 100% 4.950 3.465 N MTUS2 n/a
6 TRCN0000129310 CGAACCAATGAAGAGCTGCTT pLKO.1 1708 CDS 100% 2.640 1.848 N MTUS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535022.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02744 pDONR223 100% 58.9% 57.8% None (many diffs) n/a
2 ccsbBroad304_02744 pLX_304 0% 58.9% 57.8% V5 (many diffs) n/a
3 TRCN0000474380 TAGAGCGGAGGTTATATGCCAATG pLX_317 45% 58.9% 57.8% V5 (many diffs) n/a
Download CSV