Transcript: Human XM_011535053.3

PREDICTED: Homo sapiens general transcription factor IIF subunit 2 (GTF2F2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GTF2F2 (2963)
Length:
1300
CDS:
152..547

Additional Resources:

NCBI RefSeq record:
XM_011535053.3
NBCI Gene record:
GTF2F2 (2963)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535053.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000280283 TTGTCACAGCAATGGGCTAAA pLKO_005 230 CDS 100% 10.800 8.640 N GTF2F2 n/a
2 TRCN0000020892 GCTCCTAGAGAACATCCATTT pLKO.1 380 CDS 100% 10.800 7.560 N GTF2F2 n/a
3 TRCN0000280345 GCTCCTAGAGAACATCCATTT pLKO_005 380 CDS 100% 10.800 7.560 N GTF2F2 n/a
4 TRCN0000020893 GTGGCTAGTCAAGGTTCCTAA pLKO.1 205 CDS 100% 4.950 3.465 N GTF2F2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535053.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06339 pDONR223 100% 48.2% 43.7% None (many diffs) n/a
Download CSV