Transcript: Human XM_011535139.2

PREDICTED: Homo sapiens paraspeckle component 1 (PSPC1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PSPC1 (55269)
Length:
2375
CDS:
187..1440

Additional Resources:

NCBI RefSeq record:
XM_011535139.2
NBCI Gene record:
PSPC1 (55269)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535139.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338618 TAGGCATGAACACCAATTAAT pLKO_005 1119 CDS 100% 15.000 21.000 N PSPC1 n/a
2 TRCN0000295149 GCTAATGAGGCAAGATCTAAT pLKO_005 1140 CDS 100% 13.200 18.480 N Pspc1 n/a
3 TRCN0000156144 CGTGAGGAAGAAATGATCCGA pLKO.1 1261 CDS 100% 0.750 1.050 N PSPC1 n/a
4 TRCN0000150335 CCATACAAGCAGTTTATGGAT pLKO.1 1563 3UTR 100% 0.300 0.240 N PSPC1 n/a
5 TRCN0000154409 GAGCTGCTAGAGCAAGCATTT pLKO.1 694 CDS 100% 10.800 7.560 N PSPC1 n/a
6 TRCN0000338557 GAGCTGCTAGAGCAAGCATTT pLKO_005 694 CDS 100% 10.800 7.560 N PSPC1 n/a
7 TRCN0000152218 CGGAAGCAAATACAACTAAGA pLKO.1 1219 CDS 100% 4.950 3.465 N PSPC1 n/a
8 TRCN0000150790 GCAGTGTAATTCAGAAGAGTT pLKO.1 1418 CDS 100% 4.950 3.465 N PSPC1 n/a
9 TRCN0000154609 GCTCTGGAAAGATGTGGTGAT pLKO.1 820 CDS 100% 4.050 2.835 N PSPC1 n/a
10 TRCN0000154860 GCCTTGACTGTCAAGAACCTT pLKO.1 655 CDS 100% 3.000 2.100 N PSPC1 n/a
11 TRCN0000151650 CTTTCTCCAGTTGTTTCCAAT pLKO.1 673 CDS 100% 4.950 2.970 N PSPC1 n/a
12 TRCN0000102471 CCTGGGACATTTGAATTTGAA pLKO.1 988 CDS 100% 5.625 3.938 N Pspc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535139.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10243 pDONR223 100% 94.2% 91% None 1159_1187del;1209_1251del n/a
2 ccsbBroad304_10243 pLX_304 0% 94.2% 91% V5 1159_1187del;1209_1251del n/a
3 TRCN0000478484 GGCGCCTTGTGGTGGTGCCAATAA pLX_317 29.6% 94.2% 91% V5 1159_1187del;1209_1251del n/a
Download CSV