Transcript: Human XM_011535212.1

PREDICTED: Homo sapiens ubiquitin C-terminal hydrolase L3 (UCHL3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UCHL3 (7347)
Length:
1088
CDS:
72..956

Additional Resources:

NCBI RefSeq record:
XM_011535212.1
NBCI Gene record:
UCHL3 (7347)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535212.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007536 GCACCAAGTATAGATGAGAAA pLKO.1 738 CDS 100% 4.950 6.930 N UCHL3 n/a
2 TRCN0000320681 GCACCAAGTATAGATGAGAAA pLKO_005 738 CDS 100% 4.950 6.930 N UCHL3 n/a
3 TRCN0000007538 CCCTGATGAACTAAGATTTAA pLKO.1 911 CDS 100% 15.000 10.500 N UCHL3 n/a
4 TRCN0000320682 CCCTGATGAACTAAGATTTAA pLKO_005 911 CDS 100% 15.000 10.500 N UCHL3 n/a
5 TRCN0000007539 GTCTTACTTCTCTTTCCTATT pLKO.1 225 CDS 100% 10.800 7.560 N UCHL3 n/a
6 TRCN0000320753 GTCTTACTTCTCTTTCCTATT pLKO_005 225 CDS 100% 10.800 7.560 N UCHL3 n/a
7 TRCN0000007537 CCTGGAGGAATCTGTGTCAAT pLKO.1 437 CDS 100% 4.950 3.465 N UCHL3 n/a
8 TRCN0000320754 CCTGGAGGAATCTGTGTCAAT pLKO_005 437 CDS 100% 4.950 3.465 N UCHL3 n/a
9 TRCN0000007535 GTCAATAATGGAAACACCAAA pLKO.1 960 3UTR 100% 4.950 3.465 N UCHL3 n/a
10 TRCN0000320757 CTTGTCAATAATGGAAACACC pLKO_005 957 CDS 100% 2.640 1.848 N UCHL3 n/a
11 TRCN0000030718 GCATGGTACCAAGACCAGTAT pLKO.1 199 CDS 100% 0.000 0.000 N Uchl3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535212.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01745 pDONR223 100% 78.2% 78.2% None 475_666del n/a
2 ccsbBroad304_01745 pLX_304 0% 78.2% 78.2% V5 475_666del n/a
Download CSV