Transcript: Human XM_011535228.2

PREDICTED: Homo sapiens N(alpha)-acetyltransferase 16, NatA auxiliary subunit (NAA16), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NAA16 (79612)
Length:
1974
CDS:
291..1883

Additional Resources:

NCBI RefSeq record:
XM_011535228.2
NBCI Gene record:
NAA16 (79612)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535228.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060607 CCAAAGCAATTACACCCAGAA pLKO.1 1153 CDS 100% 4.050 5.670 N NAA16 n/a
2 TRCN0000060604 GCTCTACAAATTAGCACTTTA pLKO.1 1089 CDS 100% 13.200 9.240 N NAA16 n/a
3 TRCN0000060605 CGCATCTTGAAATGTTATGAA pLKO.1 336 CDS 100% 5.625 3.938 N NAA16 n/a
4 TRCN0000060606 GCATACCATTTGCTGAAAGAT pLKO.1 759 CDS 100% 5.625 3.938 N NAA16 n/a
5 TRCN0000060603 GCCCTCAAATTAGATAAAGAT pLKO.1 606 CDS 100% 5.625 3.938 N NAA16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535228.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14262 pDONR223 100% 80.4% 79.2% None (many diffs) n/a
2 ccsbBroad304_14262 pLX_304 0% 80.4% 79.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_15984 pDONR223 0% 58.6% 56.6% None 771T>C;906_1012del;1041_1590del n/a
4 ccsbBroad304_15984 pLX_304 0% 58.6% 56.6% V5 771T>C;906_1012del;1041_1590del n/a
Download CSV