Transcript: Human XM_011535255.3

PREDICTED: Homo sapiens calcium binding protein 39 like (CAB39L), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CAB39L (81617)
Length:
3586
CDS:
409..1422

Additional Resources:

NCBI RefSeq record:
XM_011535255.3
NBCI Gene record:
CAB39L (81617)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535255.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044249 GTGGAGTATATTAGTGCTCAT pLKO.1 754 CDS 100% 4.050 5.670 N CAB39L n/a
2 TRCN0000424890 AGACTTTGGAGGTGCCTATTT pLKO_005 1509 3UTR 100% 13.200 9.240 N CAB39L n/a
3 TRCN0000424621 ATGAACCTCCTTCGGGATAAA pLKO_005 1183 CDS 100% 13.200 9.240 N CAB39L n/a
4 TRCN0000432584 TACGTGGAGTTGTCAACATTT pLKO_005 919 CDS 100% 13.200 9.240 N CAB39L n/a
5 TRCN0000044250 GACGAGAAGAACTACTTGATT pLKO.1 1366 CDS 100% 5.625 3.938 N CAB39L n/a
6 TRCN0000044251 CCTTTGCTACTTTCAAGGATT pLKO.1 956 CDS 100% 4.950 3.465 N CAB39L n/a
7 TRCN0000044252 GCTGATAGACTTTGAGGGAAA pLKO.1 669 CDS 100% 4.050 2.835 N CAB39L n/a
8 TRCN0000044248 CAGCCCAAACTCATTGAGTTT pLKO.1 1300 CDS 100% 0.495 0.347 N CAB39L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535255.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09077 pDONR223 100% 99.7% 99.7% None 186A>G;237A>G;278G>A n/a
2 ccsbBroad304_09077 pLX_304 0% 99.7% 99.7% V5 186A>G;237A>G;278G>A n/a
Download CSV