Transcript: Human XM_011535328.2

PREDICTED: Homo sapiens nucleoporin 58 (NUP58), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NUP58 (9818)
Length:
2082
CDS:
219..1931

Additional Resources:

NCBI RefSeq record:
XM_011535328.2
NBCI Gene record:
NUP58 (9818)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535328.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013517 GCGGCACAACTTCAGTCTATT pLKO.1 1416 CDS 100% 13.200 10.560 N NUP58 n/a
2 TRCN0000297841 GCGGCACAACTTCAGTCTATT pLKO_005 1416 CDS 100% 13.200 10.560 N NUP58 n/a
3 TRCN0000013514 CCACAGGATTTACTCTAAATA pLKO.1 658 CDS 100% 15.000 10.500 N NUP58 n/a
4 TRCN0000280443 CCACAGGATTTACTCTAAATA pLKO_005 658 CDS 100% 15.000 10.500 N NUP58 n/a
5 TRCN0000013516 GCTTCAGTTTAGGATTCAATA pLKO.1 538 CDS 100% 13.200 9.240 N NUP58 n/a
6 TRCN0000280396 GCTTCAGTTTAGGATTCAATA pLKO_005 538 CDS 100% 13.200 9.240 N NUP58 n/a
7 TRCN0000013515 CCTCCACATTTGGATTTGGAA pLKO.1 1795 CDS 100% 3.000 2.100 N NUP58 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535328.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02251 pDONR223 100% 93.3% 91.8% None (many diffs) n/a
2 ccsbBroad304_02251 pLX_304 0% 93.3% 91.8% V5 (many diffs) n/a
3 TRCN0000471985 CCTTGGGCCGGACTCTACTATTCT pLX_317 19.5% 93.3% 91.8% V5 (many diffs) n/a
Download CSV